Review



pcdna4 to dcas9 vp64  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc pcdna4 to dcas9 vp64
    Pcdna4 To Dcas9 Vp64, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna4+to+dcas9+vp64/pcDNA-dCas9-VP64+(Plasmid+%2347107)/bio_rxiv__2025__11__13__688218-150-16-29
    Average 93 stars, based on 68 article reviews
    pcdna4 to dcas9 vp64 - by Bioz Stars, 2026-11
    93/100 stars

    Images

    Related Articles

    Cloning:

    Article Title: Single-component optogenetic control enables human portrait formation in cells
    Article Snippet: .. Directional cloning of Cas9 into the Blunt and BamHI site of pcDNA4.TO/MycHisA resulted in pcDNA4.TO-Cas9 plasmid. pcDNA4.TO-dCas9-VP64 was obtained through a multi-step cloning strategy. dCas9 was amplified from pcDNA3.1-CibN-dCas9-CibN (Addgene no. 60553) ( ) using oligos 5’ GATCTCGAGCATCACGATTACAAGGATG 3’ and 5’ CCCTCTAGAAACTTTGCGTTTCTTTT 3’ sequences and inserted into XhoI-XbaI site of pcDNA4.MycHisA to obtain pcDNA4.dCas9. ..

    Plasmid Preparation:

    Article Title: Single-component optogenetic control enables human portrait formation in cells
    Article Snippet: .. Directional cloning of Cas9 into the Blunt and BamHI site of pcDNA4.TO/MycHisA resulted in pcDNA4.TO-Cas9 plasmid. pcDNA4.TO-dCas9-VP64 was obtained through a multi-step cloning strategy. dCas9 was amplified from pcDNA3.1-CibN-dCas9-CibN (Addgene no. 60553) ( ) using oligos 5’ GATCTCGAGCATCACGATTACAAGGATG 3’ and 5’ CCCTCTAGAAACTTTGCGTTTCTTTT 3’ sequences and inserted into XhoI-XbaI site of pcDNA4.MycHisA to obtain pcDNA4.dCas9. ..

    Amplification:

    Article Title: Single-component optogenetic control enables human portrait formation in cells
    Article Snippet: .. Directional cloning of Cas9 into the Blunt and BamHI site of pcDNA4.TO/MycHisA resulted in pcDNA4.TO-Cas9 plasmid. pcDNA4.TO-dCas9-VP64 was obtained through a multi-step cloning strategy. dCas9 was amplified from pcDNA3.1-CibN-dCas9-CibN (Addgene no. 60553) ( ) using oligos 5’ GATCTCGAGCATCACGATTACAAGGATG 3’ and 5’ CCCTCTAGAAACTTTGCGTTTCTTTT 3’ sequences and inserted into XhoI-XbaI site of pcDNA4.MycHisA to obtain pcDNA4.dCas9. ..



    Similar Products

    pcdna4 to dcas9 vp64  (Addgene inc)
    93
    Addgene inc pcdna4 to dcas9 vp64
    Pcdna4 To Dcas9 Vp64, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcdna4+to+dcas9+vp64/pcDNA-dCas9-VP64+(Plasmid+%2347107)/bio_rxiv__2025__11__13__688218-150-16-29
    Average 93 stars, based on 1 article reviews
    pcdna4 to dcas9 vp64 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier

    Image Search Results